Alignment Guide

G tract


      7260      7270      7280      7290      7300      7310      7320
         '         '         '         '         '         '         '        
A2       GGGCCAAAAAGGGGGAGTGGGTGGGCAGGGGACTGGGGGTGGGTGGATATGGGGGACTTTT
older:                                     caya
A exp         ^
-2 gap                                          --

To try to standardize alignments in this area:

FTE and older sequences change to the caya motif at 7294. L1FTE itself requires a 2 base gap before the C, but other sequences don't have the gap and clearly indicate the C should go at 7278.

Expansion and contraction of the A run at 7265 is common. Absorb it after the C at 7264.

There is a 2 bp gap above yclade but below AFAnode that is difficult to locate between 7290 and 7305. Usually the T at 7299 is either gone or mislocated. Sometimes there are 1 or 3 bp gaps. Arbitrarily, start such gaps under the T at 7299, and extend them to the right. This assignment may be changed when more sequences in the area become available.

Length polymorphism region (lpr)

Align after Schichman et al., 1992

A2 1918..1959 is block 1

A2 1960..2001 is block 2

For elements above L1Md9, the first 24 bp of block 2 are duplicated.
Align these extra bases in a 24 bp insert prior to 1960
Number them b1960..b1983
Historically, this was a deletion from an ancestor with 2 1/2 lpr units.

         b1960     b1970     b1980
             |         |         |
             GAAGACCTTAAAGAGGAARCACAA   Schichman's consensus
             CAGGCTCTTAAAGAAAAGCAGGAA   L1MdA2
             |         |         |
          1960      1970      1980

Elements above A2node1 have a third full block
- Schichman aligned it as an insert after bp 2001, trying to keep the boundary consistent with the duplication above.
- However, that boundary clearly seems one base off, so here we will insert it after 2000
- Number it a1959..a2000
- Historically, this was a deletion from an ancestor with 2 lpr units.
```
        a1960     a1970     a1980     a1990     a2000
            |         |         |         |         |
           AGAAGTCCTTAAAGAAAAACAGGAAAACACATCCAAACAGGT  Schichman's consensus
           ACAGGCTCTTAAAGAAAAGCAGGAAAACACAGCCAAACAGGT  A2
            |         |         |         |         |
         1960      1970      1980      1990      2000
```
5' end
Opposite the tct in L1MdA2 add the 1 nt gap after 1553 gg.a in TF seqs. L1Md9 establishes this position for the gap, which otherwise would be arbitrary.
Last revision: 11/27/99

G tract

Length polymorphism region (lpr)

5' end