Demonstrate Vector NTI for tracking features on sequence as it is recombined into different clones.

     This is to be done with the site-licensed vector-NTI program.  Student will be given a paper copy of sequence from an
     expression clone pencil marked with sequence primers, vector/insert boundaries, etc.  Also some PCR primers will be
     stated to lift out subsections of the clone containing proposed protein domains.  A raw fasta file will be given. The
     demonstration is to create a Vector NTI version of the sequence with the features all marked, and then demonstrate the
     recombination with the sequence features attached.

Getting Vector NTI working:

• The first time installation of Vector NTI can take a while.  Don't wait until right before your presentation to get started.
• You have to use it on a Windows PC.  Ask permission from your supervising professor if you are going to install it on a lab PC.  In the records the lab is required to keep concerning licenses for computer software, indicate that Vector NTI is site-licensed to the Bioinformatics Core Facility and authorized through a token server.
• Contact Dr. Demeler or Jeremy Mann to get the appropriate authorization and where to get the program.
• Then follow installation instructions on the Bioinformatics Core Facility Vector NTI page.
• This link has a few more notes about installing vector NTI.
• Part of the assignment is for you to install the program and report back how much of a problem that was.  You can seek assistance, if needed, from the Bioinformatics Core Facility, but they are not supposed to do it for you.
• Before attempting an exercise, use the license manager (as indicated in the links above) to get the license for all modules.  When you run vector NTI, if there is a blinking red X in the lower right corner of a window that means you did not get authorization.  If trying the license manager again does not resolve the problem, ask Jeremy Mann (Rm 420 D) to free up a slot for you.  Alternatively, without the license you can do the project by exploring the functions and taking screen shots (print screen key on the keyboard to put an image of screen on the clipboard, followed by pasting the clipboard into MS paint and saving the image.  But without the license, you can not save your work and resume at a later time.

• Here is a link to the sequence to be examined.  This file was output from Vector NTI at another lab.  After downloading to your computer, getting it into Vector NTI should be simple.  From the main VNTI window menu bar <molecule> <open> <molecule files>, and the file type is GenPept.
• This is an expression clone.  There is an N-terminal GST affinity domain (258..958), followed by the protein under examination named L1orf1p.  There are critical EcoRI sites (GAATTC) at the GST-L1orf1p fusion site, and downstream of L1orf1p.  Find them and mark them.
• The EcoRI sites among others are probably already marked by default.  From the main menu choose <analysis><restriction> and add or subtract sites from the list to be marked to taste.
• The protease that cleaves the GST domain away cleaves just before the sequence GPLGSPEF.  Mark the cleavage site.
• First translate each orf in turn by clicking on it in the graphics pane, and using from the main menu <analysis><translate><In sequence pane>.
• Notice that the coordinate provided for the end of the L1 insert orf is incorrect.  Use from the main menu <edit> <set selection> to repair it.
• Find the protease site GPLGSPEF between the two frames, highlight it in the sequence pane, then use from the main menu <edit><new><Add feature to Fmap> to add a feature named "Protease Site".
• You should be looking at something like this.  Save your work.

• The version of the L1orf1p gene sent was discovered to be a mutant.  It was replaced with the sequence in GenBank entry gi|1483148 (obtain by putting 1483148 in the NCBI Entrez nucleotide search box; in a browser at http://www.ncbi.nlm.nih.gov/).  Download the file to your disk using the "SEND" button  on the Entrez page.
• PCR primers used to amplify the non mutant version from the clone described in gi1483148 and effect the replacement were:
• oRELORF1-1: tccccggaattcatggcgaaaggtaaacgg
• oRELORF1-2: gtacgggaattccttcttgttttttctagg
The strategy was to amplify with these primers and cut with EcoRI. Also the original plasmid was cut with EcoRI.  The the vector from the original plasmid and the insert from the PCR product were ligated together, and orientation was confirmed by sequencing (see below).
• You should use the facilities of Vector NTI to make a display indicating what bases were changed and what amino acids were changed by this replacement.  Do this as follows:
• Open the downloaded file (GenPept format) as before.
• Use the main menu <edit> <find> command to find the priming portion of oRELORF1-1 (atggcgaaaggtaaacgg).
• Highlight all sequence to the left and press <del>
• Type in the EcoRI site of the primer directly in the sequence pane.  The 5' end is irrelevant, since it will be lost during the replacement.
• Similarly clean up the right end leaving just an EcoRI fragment.
• You should be looking at something like this.  Save your work with a new name.
• Using the <del> and <edit><copy> and <edit><paste> commands, construct the recombinant molecule.
• Note that some features will transfer to the recombinant, while some will have to be remade or resized.  In particular, the new fused reading frame will have to be added as a new CDS feature, and it and the protease site will have to be resized.
• Note that something went wrong at the 5' end.  The intent was to move the EcoRI site up and cut off some extraneous nucleotides.  Inadvertantly, the terminator was removed, so now there is an extraneous C terminal tail on the protein.  This is the kind of error you hope to avoid if you explore the contruct in advance the way this demonstration is exploring it.
• For the original and the recombinant construct in turn, select the fusion CDS, and do <analysis><translation><into new protein>, and save the resulting protein entry.
• Select <alignx> from the main menu, load both the original and the recombinant protein entries by <molecule><add file>, and see that both are highlighted in the upper left pane.  Then  select <align> from the main toolbar and align the two molecules.  Examining this result reveals one amino acid replacement (which was the point of the construction) plus the extraneous C terminal tail.
• Mark those two features on the recombinant molecule as miscellaneous features.
• You should be looking at something like this.  Save your work.

You should be able to proceed on your own by now.  Check out the proposed constructs below to be sure that there are no blunders such as the protein will be out of frame, or the terminator is missing.
 

• The new construct was confirmed by sequencing with the following primers.  Mark their positions as features.
• oReeler2293-:  tgtgttctcttagtgtctgt
• oReeler2002-:  atgtttgctggacctttg
• oReeler1704-:  ttccctttttaggactagta
• oReeler2219+:  ggcaagcctatcagaat
• oReeler1921+:  aaatatccaggaaatcca
• oReeler1621+:  ggaaaacacaatcaaaca
• oPJS46B-894U18+:  ggcgaccatcctccaaaa
• oPJS46B-1433L19-:  tcaccgtcatcaccgaaac
• Three new constructs containing domains of the L1orf1p protein were created by amplifying with the following 3 primer pairs:
• domain 1
• oAG1c: ggatcagaattccaaaatatccaggaaatc
• oAG1d: ttcagcgaattctcagccctttatatgttacc
• domain 2
• oAG1a: ggatcagaattccaggtaacatataaaggc
• oAG1b: ttcagcgaattctcattctgttattatcctttg
• domain 1+2
• oAG1c
• oAG1b
• Use Vector NTI to make a figure displaying this construction.  Do it so as to keep track of which of the above sequencing primers are useful for confirming the new constructs, and which of the amino acid changes from the original insert replacement are in the new domains.
• Your overall task is to show us and evaluate how good are the facilities in Vector NTI for keeping track of features through serial constructions.  How hard is it to use? What is the quality of figures it make? How hard is it to convey this information in some electronic form to someone who is not using Vector NTI?