Use Oligo 6.0 under Site License to design PCR primers for a domain isolation construction.

• The DNA sequence present in a clone given to you and a translated version of it appear below.
• The planned construction is to lift two overlapping domains out of the clone by PCR such that the insert will have ends cut off with EcoRI and placed in an EcoRI site of an expression vector.  This is a fusion construction such that the EcoRI site (GAATTC) must appear immediately before the initiator codon on the 5' end.  The last codon must be followed by a terminator, and then an EcoRI site.  There should be 6 arbitrary bases outside of the EcoRI site in the part of each primer that will be cut away.
• The first domain should start at 1689 (starting with residues DQK in bold below) and extend to the indicated terminator below.
• The second domain clones should start at the same place but end after 1855 (after WTD in bold below)
• To get you started, this document will describe partway getting primers for the first targetted domain.  Those primers are flawed, however.  You are to use Oligo to find the problem, and design good primers for both domains.  You should take screen shot for your presentation illustrating the various relevant features of the program.
• Follow the instructions at the Bioinformatics Core Facility Genomics Page to access The UTHSCSA site-licensed copy

     of Oligo 6.0.  This will require a Windows PC computer.  You don't actually install Oligo6.0 on the PC. Rather it
     appears in a shared folder under Network Neighborhood and runs over the net.  Here are some additional notes on getting connected.
• Your PC must be set up to access Microsoft networking.  From outside the UTHSCSA domain you must have installed a vpn connection, and activate that first.  If your computer is running a firewall, then it must be configured to allow Microsoft Networking to pass. For example, for zonealarm you would enter biodna.uthscsa.edu as a "local" or "trusted" computer, then set the "local" or "trusted" zone to medium security for the duration of your interaction with Oligo.
•  You can avoid the "network neighborhood" icon altogher by typing //biodna.uthscsa.edu in the toolbar <start><run> box. Enter your username and password for BIODNA when prompted. (MS windows prior to win2000 will use your desktop username and password automatically rather than prompting for them, so you may have to create a user by that description and login to the PC as such).
• Click the Oligo6.0 folder in the window that opens.
• Once you see the Oligo folder, right click on it and create a shortcut on your desktop to simplify accessing the program in the future.
• Since the positions of the oligos are largely fixed by the nature of the construction, the problem is to adjust oligo length and the sequence of the arbitrary bases to balance the Tm's and avoid self priming and hairpin problems.

      901 atcctccaaa atcggatctg gaagttctgt tccaggggcc cctgggatcc ccggaattca
      961 tggcgaaagg caaacggagg aatcttacta acaggaacca agaccactca ccatcaccag
     1021 aacccagcac acccacttcg cccagtccag ggaaccccaa cacacctgag aacctagacc
     1081 tagatttaaa agcatatctc atgatgatgg tagaggacat caagaaggac tttaataaat
     1141 cacttaaaga aatacaggag aacactgcta aagagttaca agtccttaaa gaaaaacagg
     1201 aaaacacaat caaacaggta gaagtcctta cagaaaaaga ggaaagaaca tacaaacagg
     1261 tgatggaaat gaacaaaacc atactagacc taaaaaggga agtagacaca ataaagaaaa
     1321 ctcaaagcga ggcaacacta gagatagaaa ccctaggaaa gaaatctgga accatagatt
     1381 tgagcatcag caacagaata caagagatgg aagagagaat ctcaggtgca gaagattcca
     1441 tagagaacat cggcacaaca atcaaagaaa atggaaaatg caaaaagatc ctaactcaaa
     1501 atatccagga aatccaggac acaataagaa gaccaaacgt acggataata ggagtggatg
     1561 agaatgaaga ttttcaactc aaaggtccag caaacatctt caacaaaatt attgaagaaa
     1621 acttcccaaa tctaaagaat gagatgcata tgaacataca agaagcctac agaactccaa
     1681 atagactgga ccagaaaaga aattcctccc gacacataat aatcagaaca tcaaatgcac
     1741 taaataaaga tagaatacta aaagcagtaa gggaaaaagg tcaggtaaca tataaaggca
     1801 agcctatcag aattacacca gatttttcac cagagactat gaaagccaga agagcctgga
     1861 cagatgttat acagacacta agagaacaca aactgcagcc caggctacta tacccagcca
     1921 aactctcaat tatcatagag ggagaaacca aagtattcca cgacaaaacc aaattcacgc
     1981 attatctctc cacgaatcca gcccttcaaa ggataataac agaaaaaaac caatacaaga
     2041 acgggaacaa cgccctagaa aaaacaagaa ggtaatccct caacaaacca aaaagaagac
 

    258 atgtcccctatactaggttattggaaaattaagggccttgtgcaa
        M  S  P  I  L  G  Y  W  K  I  K  G  L  V  Q
    303 cccactcgacttcttttggaatatcttgaagaaaaatatgaagag
        P  T  R  L  L  L  E  Y  L  E  E  K  Y  E  E
    348 catttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaag
        H  L  Y  E  R  D  E  G  D  K  W  R  N  K  K
    393 tttgaattgggtttggagtttcccaatcttccttattatattgat
        F  E  L  G  L  E  F  P  N  L  P  Y  Y  I  D
    438 ggtgatgttaaattaacacagtctatggccatcatacgttatata
        G  D  V  K  L  T  Q  S  M  A  I  I  R  Y  I
    483 gctgacaagcacaacatgttgggtggttgtccaaaagagcgtgca
        A  D  K  H  N  M  L  G  G  C  P  K  E  R  A
    528 gagatttcaatgcttgaaggagcggttttggatattagatacggt
        E  I  S  M  L  E  G  A  V  L  D  I  R  Y  G
    573 gtttcgagaattgcatatagtaaagactttgaaactctcaaagtt
        V  S  R  I  A  Y  S  K  D  F  E  T  L  K  V
    618 gattttcttagcaagctacctgaaatgctgaaaatgttcgaagat
        D  F  L  S  K  L  P  E  M  L  K  M  F  E  D
    663 cgtttatgtcataaaacatatttaaatggtgatcatgtaacccat
        R  L  C  H  K  T  Y  L  N  G  D  H  V  T  H
    708 cctgacttcatgttgtatgacgctcttgatgttgttttatacatg
        P  D  F M  L  Y  D  A  L  D  V  V  L  Y  M
    753 gacccaatgtgcctggatgcgttcccaaaattagtttgttttaaa
        D  P  M  C  L  D  A  F  P  K  L  V  C  F  K
    798 aaacgtattgaagctatcccacaaattgataagtacttgaaatcc
        K  R  I  E  A  I  P  Q  I  D  K  Y  L  K  S
    843 agcaagtatatagcatggcctttgcagggctggcaagccacgttt
        S  K  Y  I  A  W  P  L  Q  G  W  Q  A  T  F
    888 ggtggtggcgaccatcctccaaaatcggatctggaagttctgttc
        G  G  G  D  H  P  P  K  S  D  L  E  V  L  F
    933 caggggcccctgggatccccggaattcatggcgaaaggcaaacgg
        Q  G  P  L  G  S  P  E  F  M  A  K  G  K  R
    978 aggaatcttactaacaggaaccaagaccactcaccatcaccagaa
        R  N  L  T  N  R  N  Q  D  H  S  P  S  P  E
   1023 cccagcacacccacttcgcccagtccagggaaccccaacacacct
        P  S  T  P  T  S  P  S  P  G  N  P  N  T  P
   1068 gagaacctagacctagatttaaaagcatatctcatgatgatggta
        E  N  L  D  L  D  L  K  A  Y  L  M M M  V
   1113 gaggacatcaagaaggactttaataaatcacttaaagaaatacag
        E  D  I  K  K  D  F  N  K  S  L  K  E  I  Q
   1158 gagaacactgctaaagagttacaagtccttaaagaaaaacaggaa
        E  N  T  A  K  E  L  Q  V  L  K  E  K  Q  E
   1203 aacacaatcaaacaggtagaagtccttacagaaaaagaggaaaga
        N  T  I  K  Q  V  E  V  L  T  E  K  E  E  R
   1248 acatacaaacaggtgatggaaatgaacaaaaccatactagaccta
        T  Y  K  Q  V  M  E M  N  K  T  I  L  D  L
   1293 aaaagggaagtagacacaataaagaaaactcaaagcgaggcaaca
        K  R  E  V  D  T  I  K  K  T  Q  S  E  A  T
   1338 ctagagatagaaaccctaggaaagaaatctggaaccatagatttg
        L  E  I  E  T  L  G  K  K  S  G  T  I  D  L
   1383 agcatcagcaacagaatacaagagatggaagagagaatctcaggt
        S  I  S  N  R  I  Q  E  M  E  E  R  I  S  G
   1428 gcagaagattccatagagaacatcggcacaacaatcaaagaaaat
        A  E  D  S  I  E  N  I  G  T  T  I  K  E  N
   1473 ggaaaatgcaaaaagatcctaactcaaaatatccaggaaatccag
        G  K  C  K  K  I  L  T  Q  N  I  Q  E  I  Q
   1518 gacacaataagaagaccaaacgtacggataataggagtggatgag
        D  T  I  R  R  P  N  V  R  I  I  G  V  D  E
   1563 aatgaagattttcaactcaaaggtccagcaaacatcttcaacaaa
        N  E  D  F  Q  L  K  G  P  A  N  I  F  N  K
   1608 attattgaagaaaacttcccaaatctaaagaatgagatgcatatg
        I  I  E  E  N  F  P  N  L  K  N  E M  H  M
   1653 aacatacaagaagcctacagaactccaaatagactggaccagaaa
        N  I  Q  E  A  Y  R  T  P  N  R  L D  Q  K
   1698 agaaattcctcccgacacataataatcagaacatcaaatgcacta
        R  N  S  S  R  H  I  I  I  R  T  S  N  A  L
   1743 aataaagatagaatactaaaagcagtaagggaaaaaggtcaggta
        N  K  D  R  I  L  K  A  V  R  E  K  G  Q  V
   1788 acatataaaggcaagcctatcagaattacaccagatttttcacca
        T  Y  K  G  K  P  I  R  I  T  P  D  F  S  P
   1833 gagactatgaaagccagaagagcctggacagatgttatacagaca
        E  T  M  K  A  R  R  A  W  T  D  V  I  Q  T
   1878 ctaagagaacacaaactgcagcccaggctactatacccagccaaa
        L  R  E  H  K  L  Q  P  R  L  L  Y  P  A  K
   1923 ctctcaattatcatagagggagaaaccaaagtattccacgacaaa
        L  S  I  I  I  E  G  E  T  K  V  F  H  D  K
   1968 accaaattcacgcattatctctccacgaatccagcccttcaaagg
        T  K  F  T  H  Y  L  S  T  N  P  A  L  Q  R
   2013 ataataacagaaaaaaaccaatacaagaacgggaacaacgcccta
        I  I  T  E  K  N  Q  Y  K  N  G  N  N  A  L
   2058 gaaaaaacaagaaggtaa 2075
        E  K  T  R  R  *

Proceed as follows:
 

• Click on Oligo 6.0 to run the program.
• For the first construct, Get the relevant DNA segment into Oligo as follows:
• On the main tool bar, click on <file>, then <new sequence> to open an editor.
• Highlight from 1689 to 2075 on the DNA listing above, cut, and paste into the editor.  Notice that Oligo correctly ignores the numbers and spaces in the inserted sequence and reformats it appropriately.
• Verify that your segment starts with gac and ends with taa.
• From the Accept/Discard item on the tool bar, accept the sequence and close the editor.
• On the main display, arrange the "melting temperature" and "internal stability" windows to be visible.
• Finding Tm of a prospective forward priming oligo.
• The only part of the oligo that is important to the intial priming Tm is the part that overlaps the template.  Click the leftmost nucleotide in the Tm window.
• Click the <change> main toolbar item and select an oligo length of 23. Note the predicted Tm in the Tm window of 71 C.
• Click the <change> main toolbar item and then <non search parameters>.  Note that the conditions currently governing the calculation are not much like a PCR reaction buffer.  These conditions actually reflect a standard filter hybridization experiment.  Fill in 50mM for monovalent ion concentrations, 0.7 for free Mg, and 600000 pM for concentration of oligos.  These reflect PCR reaction conditions I happen to use.  You would, of course, match the buffer you happen to use. Accept these and note that the predicted Tm has changed to 72 C.  If you play with the individual conditions one at a time, you will see that this small change is produced by large offsetting changes from each of the three conditions.  This menu is particularly useful for exploring the effect of different Mg concentrations.
• You should be looking at something like this.
• 72 is much more thermostable than we need, especially considering that after the first round, the template will pair to the full length of the primer and be even more thermostable.  Note on the "internal stability" window that this primer has high stability of the 3' end priming alone, and hence is a risk to get into a variety of noise problems.
• Try again.  Change the primer length to 20.  The predicted Tm is now 61 C.  So Let's take the 20 mer as the first guess at an acceptable primer.
• Use the <select> toolbar item to select this as the "upper" (meaning forward) primer.
• Finding a partner
• Scroll the Tm window to the right end and pick the last 20 bases.  Note that the projected Tm is only 55.5, so change length to 22 to balance the Tm's between the two primers.
• Select this as the lower primer.
• Use the <edit> toolbar item to edit the lower and upper primer to add 6 to 8 arbitrary bases followed by GAATTC to the 5' end of each.  Be sure to put it on the 5' end of the lower primer.
• The methods in the Analyze toolbar item can now be used to examine this priming pair for problems.
• If these primers as proposed are used to do PCR under the following standard conditions they fail to raise the desired product.
• prime at 55 C, dilute template to 1 nanogram, 20 cycles of PCR.
• From the Oligo analysis results, the problem should be apparent.  You should both be able to suggest altering the experimental conditions to give a better chance that these primers will work.  Also, you should be able to design primers that will be more likely to work in the first place.
• Carry on and find candidates for the 2nd set of primers.